SNP/Locus Name /TSC Designation:  TSC 0078283

 

 

General Information

GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

NT_011512     NT_011512.8

 

 

ss  1464719

Chr 21

rs  1003473

33,107,033

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

C/G

minus strand

 

 

Reference Sequence 

5’ flank: taaaaagtat aaaataagca cagtgtgttt atctaggaca gtgattttta cactacaaat

              acagttataa ttttcttaaa actagatatg agtatgttct aaaaggttac actcaaaaat

              caaaatggtt ttttgatctg ttggtagagg tgatttcttt tattttgatt ttccttgcta

              tgttaccaag ttccatatac tcaaaatggt tgagacattg ctcttatttt ctggattttt

              tttaaaggct caagcagtca gattccacaa cattttgtac tctttaagaa gactggaaaa

              tgcaaagtgc catttagcca gtttgcacag attccaaaaa atgaaccagg taaatttcct

              ggtgtagttc ccagtgtatt agactttcta ttgctgctgt aacaaataac cacaaactta

              gtggcttaaa acaaaacaaa tttattctct tacagttctg cagattagaa atttgacatg

              aatctcatgg ggctaaagtc aaggggtcag cagggctgca ttcctttcca gagactctaa

              ggcagaatcc attttcttgt tttattcagc ttctagaagc tgcccacatt atttggcttg

              tggactcctc ctccatcttc aaagccagca aagggtggtt gagtctttct catgtcatgc

              cactctgaca ctgatgctt

Observed:  S(c/g)

3' flank: tgtctctcga gtccactttt aaggatgctt gtgattacat tgggcccatc cagagagtcc

              aagccaatct ccccatttca aggttcttat cacatccatg aagctctttt gccacgcaag

              gctacttact cgcagaatgg ccactggtgg ttaccaacca gtttaagtct tccttcttcc

              aataccttgt atgagtttga cctcagtcca tccaattcag aacttgacta taagttatta

              gttctaattt accatatacc tactatttca ttgagctttg ggaatgttaa ggatgtatct

              gatctcttca ctgtatcgct agttcacatg agacaaatgg actgtcagtc tttgcccata

                   

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

G = 30%

C = 70%

1

FSS Indo-Pakistani (33)

G = 53%

C = 47%

1

FSS Afro-Caribbean (29)

G = 28%

C = 72%

1

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  tgccactctgacactgatgctt(c/g)

1

Reverse  Primers  :   aatggggagattggcttggac

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent to other              

markers-Y SNPs, present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1): 140 bp

PCR Cycling Conditions: 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctattgccactctgacactgatgcttg

                              Forward Universal Sequence 2: tgacgtggctgacctgagactgccactctgacactgatgcttc

                              Reverse Universal Sequence    : caagctggtggctgtgcaagaatggggagattggcttggac

 

 References

1      FSS SNP PAPER

 

 

 

 RETURN TO HOMEPAGE