SNP/Locus Name /TSC Designation:  TSC 0131214

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

 NT_026437.10    NT_026437   AL132640.4

 

ss  100540

Chr 14

rs  749270

61,846,775

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

plus strand

 

 

Reference Sequence 

5' flank: ctgttaaaac gttctactct ggcaagatgt ggtgggcttg gagcttagaa aggaaactgg

          ggttatgcta gtgctctgca agggccctgc ccagataaaa ttgttggtct tgtctgtaat

          tagtattcca aaggttcagg tggtgttgca tctccatatc aatgttcagc tagtaggtaa

          agggacatat ttggagggaa ctaactctgg cctagctact attatgctct tcactttttc

          ttttttattc tctcaagccc cagcatcatg cagtcctcag ttgggtgctt acgtgc

Observed:  W(a/t)

3' flank: cttctcttcc ttgcagcagt cctcgaggca gggcagattc ctctttaagg tgctcgcatg

          ttacccctgg gttctgctga cccaacatta gctacaaagt gggacagtcc cacagtgctc

          cctcttcctt gttgtgggga agaccgcaaa aagacctctt ttgctttagt gactttgttc

          ctactcaata caggaagtgt tgaccagcaa aaataataat tacaaaggct aagttctgat

          ttattgttcc tgactcccgt gtgattaact ggaaaccctg ttgttctcct ttttaatcct

          aaagttagag tttgccaaac ctactcctcc tttaatacca cccctgctaa aagggagatc

          tccaatccct ttcttaagag gcccctttcc tgttgtaagc taaccagagc agacactggg

          cctcctttct cagaagggca ctgcgcatct g

          

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

T = 90%

A = 10%

1

FSS Indo-Pakistani

 

 

 

FSS Afro-Caribbean

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  ctcagttgggtgcttacgtgc(a/t)

1

Reverse  Primers  :   aagagggagcactgtgggactg

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent to other               

markers-Y SNPs, present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1): 188 bp

PCR Cycling Conditions: 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences:  Forward Universal Sequence 1: cgacgtggtggatgtgctatctcagttgggtgcttacgtgca

                              Forward Universal Sequence 2: tgacgtggctgacctgagacctcagttgggtgcttacgtgct

                              Reverse Universal Sequence    : caagctggtggctgtgcaagaagagggagcactgtgggactg

 

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE