SNP/Locus Name /TSC Designation :   TSC 0155410

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

  AC005659.3  AC005658  AC006173.1  AL356419.4 NT_030059  NT_030059.10

 

ss  1315218

Chr 10

rs 181619

118,606,454

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/C

Minus strand

 

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

5' flank: cagggctggg tcaagctgtc ccattgggtg ggtctttccg atgcaaagtt actggtcttc

          cagaagttct cctgcatctt ttccttccct ccccactgct ccaccatgct gtagttcagc

          tcttcatccc tcacacccgg acaactcaac ctcttccaag tggcctctgc ccccagtcta

          tcccccactg ttgtagcaga tcactttgct gcttttatgc agaaaacttc agtggctctg

          ccgctcccag gaaacagtgg agacccctca gccctgcact caggacctgc tcagtgcaac

          cctcgcttcc ttgccaaccc caatctccaa cactttctaa cgctgcttcc actcccaggc

          cctgttccct cctggagggc aacagagggt ctgtcttctt gcctggagca tgagctgacc

          a

Observed:  M(a/c)

3' flank: agggggtcct gaagagagag ccacttggca ggggcaccgg cagatgctgg aagggacttc

          cacacatagc cacccctcac acccactccc cattgttctt cagagcctca cccagaagaa

          cacagatttg caggcccact ttggtacgtg tcggagaaca tggagagcca gtcctaaggc

          ataaagggaa accaagtcac agttgg

         

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

C = 70%

A = 30%

1

FSS Indo-Pakistani (33)

C = 82%

A = 18%

1

FSS Afro-Caribbean (29)

C = 78%

A = 22%

1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : cctggagcatgXgctgacca(a/c)

1

Reverse  Primers  : ggctctgaagaacaatggggag

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

X = Inosine

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus,

equivalent to other markers-Y SNPs,    present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 168bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctat cctggagcatgXgctgaccac

                              Forward Universal Sequence 2: tgacgtggctgacctgagac cctggagcatgXgctgaccaa

                              Reverse Universal Sequence    : caagctggtggctgtgcaag ggctctgaagaacaatggggag

 

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE