SNP/Locus Name /TSC Designation :   TSC 0156245

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

 AC006541.1

ss  1315902

Chr 19

rs  887754

31,034,016

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

C/T

plus strand

 

 

Reference Sequence 

5' flank:       tcccaggtgt gagctagggc accatggagc aggactgagc tctcacctcc aactccacct

                    cagccatcag gagcctccta gccagcctca gtttatccag tagtgagatg ggggtaatga

                    tagccctgac ctaacagtgg tgtttgttgt gaggattaaa agagtgaagg tgtggcgagc

                    atttggaata gcacctagtg atagtataat agcatttggt aaatgttatt ggatattatt

                    atatggtaca tccatcagcg tgtagagcgt gtatctttgt gtgcagagcc tgtgtgagtg

                    cgtgtgtgtt ctcactatgt gcacccctgt ggatgtgtgt gacacacagt gcacatatct

                    gtgtctagag gggttgccca tgtctctatg tgtgatcaac ccaggcccac acgcttcctg

                   gggtgcccac aagcatggtt tcctaatggc ttcatctcct gcccctcaag ttctgttctt

                   tccatctccc catgtcaccc tcctgccttg gctcccagc

Observed:   Y(c/t)

3' flank:     cagcctgcac atggcctgtc cctcccaacc cctccagcct gcccccacct cctgccattg

                    ctcgaaatac cttcagggat gttcaggct

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

T = 8%

C = 92%

1

FSS Indo-Pakistani (22)

T = 11%

C = 89%

1

FSS Afro-Caribbean (34)

T = 3%

C = 97%

1

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  ctgccttggctcccagc(c/t)

1

Reverse  Primers  :   cctgaacatccctgaaggtatttcg

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent to other               

markers-Y SNPs, present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1) : 145 bp

PCR Cycling Conditions: 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatctgccttggctcccagcc

                              Forward Universal Sequence 2: tgacgtggctgacctgagacctgccttggctcccagcg

                              Reverse Universal Sequence    : caagctggtggctgtgcaagcctgaacatccctgaaggtatttcg

 

 References

1               FSS SNP PAPER

 

 

 RETURN TO HOMEPAGE