SNP/Locus Name /TSC Designation :   TSC 0252540

General Information

GenBank Entries

NCBI Submitted SNP ID /NCBI Reference SNP ID

Genomic location

  NT_005927.12  AC008042      AC048350.9    AC066583.2    AC066583.3

ss 1493247/rs 420426 Chr 3  9,092,246

General Details

Polymorphism

(ancestral/derived, if known)
Orientation with respect to GenBank accession (+/-)
T/C Plus strand

Reference Sequence 

5' flank: cagatggagc tatctgggct ggagagacaa acatggaagc cagcagcaag gagttggatg

          ctatttaaaa ccacagaaca acaaggaagg ctttacaaat gctgtggcca catggcagaa

          gaggtcaatc cccgggaagc atggcaaggc tgtggccgga gggctggggc agggccaagc

          cgcggtggcg cctcccctcc tgcttcccta aaagagggca agatggggca atgtgcagcc

          tggcctcctc tgagatgctg tcccaggcct gccgtccgat cagcggccca ttctctaggt

          ccatcccagc atgggaaact gctgggtctg

Observed:  Y(c/t)

3' flank: acccccacct tctcccagcc ctggctccct cctgtggggc aggtcatttg tagtctaaaa

          ggctggggtg aactgtccac agccagggtc aagagctgct ctgtagaaag ctagcatgtg

          tggccttggc cacaatggta ccaggcaggc tctaccacat ctgaaagaag aaggcccaca

          ggtgggactc agcacagcag tagagaacag aaagccacct ggacgtgggc atgggtgttc

          accggcgtct gccatgctag ctgtggactc cgggcaggcc acctattccc tgtagcctgg

Population Allele Frequencies

Panel (No. of Individuals) Allele 1 Frequency Allele 2 Frequency References
TSC Panel  (40) T = 52% C = 48% http://snp.cshl.org
FSS N. European (86) T = 58% C = 42%  
FSS Indo-Pakistani (33) T = 36% C = 64%  
FSS Afro-Caribbean (29) T = 34% C = 66%  
       
       

 

Detection Protocols

Detection Protocol PCR Primer/Probe Sequences Reference
FSS URP Autosomal SNP Detection Protocol Forward Primer(s) : ggaaactgctgggtctg(c/t)  
  Reverse  Primers  : aatgacctgccccacaggag  
  Detection Probe: n/a  

 

General Comments

95c 11mins ; 94c 30s,

60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

94c 30s, 76c 105s                                                     x29 Cycles

94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

60c 10min

Forward Universal Sequence 1: cgacgtggtggatgtgctat ggaaactgctgggtctgt

Forward Universal Sequence 2: tgacgtggctgacctgagac ggaaactgctgggtctgc

Reverse Universal Sequence  : caagctggtggctgtgcaag aatgacctgccccacaggag

 

References

  http://snp.cshl.org/cgi-bin/snp?name=TSC0252540

 

 RETURN TO HOMEPAGE