SNP/Locus Name /TSC Designation :   TSC 0320706

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

 AL354718.3    AL354718    AL591479    AC027516 AL162252.1    AL354718.1    AL591479.3    NT_078053.1

ss  2898271

Chr  9

rs  1988436

44,067,658

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

minus strand

 

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

 5' flank:     taaactattt tataggaaaa ataattcttt ccttccctgt tataccaaat acagccttta

                 gctcaagaca caagtaattc caggaaaact ggaatgtaag ttcaatatgt tgcactaagt

                 acatttgaaa gtgcatgcat ttttatttta attcatcatt ctcagtcaac tatcgcaagg

                 acaaaaaacc aaacaccgca tgttctcact tataggtggg aattgaacaa tgagaacaca

                 tgaacacagg aaggggaaca tcacactctg ggggctgttg tggggtgggg agagcgggga

                 gggatagcat taggagatat gcctaaggct aaatgtcgag ttaatgggtg cagcacacca

                 gcatggcaca

Observed:  W(a/t)

3' flank:    gcatacatat gtaatgtata catatgttaa tgcaccaatt ctgcatcaag tcagtgcaat

                cagagacact gcaagaatga cttttggttt tcttttccta gtttttgaaa gtttatcaag

                tctgtcatac tggactctgt attacatctt gaattttttt cacttactat agatctccta

                tacgctcaat tgtttagcta ttaccttaac atttaccctg tgtacccatg acatttgagg

                ctgccaaagt gattattaca taaaaaaaca tatactc

         

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (27)

T =  67%

A =  33%

1

FSS Indo-Pakistani (23)

T =  80 %

A =  20%

1

FSS Afro-Caribbean (15)

T =  50%

A =  50%

1

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  gcacaccagcatggcaca(a/t)

1

Reverse  Primers  :   ctctgattgcactgacttgatgca

Detection probe   :    n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus,

equivalent to other markers-Y SNPs, present in commercial assay)

 

Present in FSS  2nd Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 124 bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatgcacaccagcatggcacaa

                              Forward Universal Sequence 2: tgacgtggctgacctgagacgcacaccagcatggcacat

                              Reverse Universal Sequence    : caagctggtggctgtgcaagctctgattgcactgacttgatgca

 

 References

1      FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE