SNP/Locus Name /TSC Designation :   TSC 0421768

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

  NT_008046
NT_008046.13 
AC027258.2

ss  2384956

Chr 8

rs 1542931

91,669,649

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

C/G

plus strand

 

 

Reference Sequence 

5' flank: ttagagattt gaggtggggt aaggggcatg gtgttcgggg acaacattgt cctctgggag

          ctcagcatct tcttgataga tgagtcatgc acatggagaa aattgaatat ttttcttttc

          tttttttttt ttcttttttt tgagacagag tcttgctctg tctcccaggc tggagcgcag

          tggtgcaatc tcggctcacc gcaacctcca cctcccaggt tcaagagatt ctcctgcctc

          cgcctcccga gtagctggga ctacaggcgc ttgccaccat gcccggctaa ttttttgggg

          ttttgttcag cagagacagg gtttcactct gttagccagg atggtctcga tctcctgacc

          tcatgatcca cctgcctcgg cctcccaaag tactgggatt acaggcgtga gccactgcac

          ctggcgaaaa ttgattaatt ttcaacatca acgtcaacag cacaactctg ctacagcgaa

          gagctacagc aaatgaagca tcaataattt tcaatg

Observed:  S(c/g)

3' flank: gttcacaatg caagaggcat cactaagcca aatgagtgag aaaacaccct aatgcattag

          agttctgagg aggaagaggt ct

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

FSS N. European (86)

C = 73%

G = 27%

1

FSS Indo-Pakistani (33)

C = 74%

G = 26%

1

FSS Afro-Caribbean (29)

C = 62%

G = 38%

1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : gatgcctcttgcattgtgaac(g/c)

1

Reverse  Primers  :  gctcaacagcacaactctgctacagc

Detection probe   :   n/a

 

 

General Comments 

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (2)  : 113bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctat gatgcctcttgcattgtgaacg

                              Forward Universal Sequence 2: tgacgtggctgacctgagacgatgcctcttgcattgtgaacc

                              Reverse Universal Sequence    : caagctggtggctgtgcaaggctcaacagcacaactctgctacagc

 

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE