SNP/Locus Name /TSC Designation :   TSC 0683201

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

 AC019089.3    NT_006216    NT_006216.14

 

 

ss  2270014

Chr  4

rs  1453461

72,703,499

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

plus strand

 

 

Reference Sequence  (FASTA format; at least 200 bp on either side of the SNP for primer/assay design)

 

 5' flank:    gagcattggc tgggtttaca tctgcatttt ggctcagctt ttcctgactg tgtgatcttg

                 ggaaagtatt taactttata aaaattaatt gttgcatgtc aaatgacaat atttgcattt

                 tagagtgttc ctattttttt gcgtctgccc tacaagccat gacagcaatt tttcctggaa

                 tcttccttcc tctaacctgt catccacatg gctaccctgg aaattgccaa ggtggtaaaa

                 aaaaaaaaaa aaaaaaaaga gtgagttttc cactctccag tctacccatt tacctgtact

                 ggggctttcc ctttcctacc actgctgtct gtgg

Observed:  W(a/t)

3' flank:     gggtcaaatg tcctatgctc tatttggggg cacttatgag tgtcctgcct aatgataatg

                acagttccca tggaggttct gcaaagtctt gaggcataga cagatactaa tatgctggac

                agttcactat catcagtgga ggccactgat ggtggcagct gttatccgcc caacgatgac

                 gacagccact gaatggttta ttctgccaaa

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (27)

T = 24%

A = 76%

1

FSS Indo-Pakistani (23)

T = 26%

A = 74%

1

FSS Afro-Caribbean (15)

T = 47%

A = 53%

1

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  tttcctaccactgctgtctgtgg(a/t)

1

Reverse  Primers  :   ctcataagtgcccccaaatagagca

Detection probe   :    n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus,

equivalent to other markers-Y SNPs, present in commercial assay)

 

Present in FSS  2nd Autosomal SNP Multiplex Assay (1)

Amplicon size in PCR (1)  : 104 bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctattttcctaccactgctgtctgtgga

                              Forward Universal Sequence 2: tgacgtggctgacctgagactttcctaccactgctgtctgtggt

                              Reverse Universal Sequence    : caagctggtggctgtgcaagctcataagtgcccccaaatagagca

 

 References

1               FSS SNP PAPER

 

 

 RETURN TO HOMEPAGE