SNP/Locus Name /TSC Designation:  TSC 0709016

 

 

General Information

GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

AC022985.2   AC097638.2   AC024378.2    AC138808.1

NT_005825.15    NT_005825

ss  2306022

Chr 3

rs  1482650

42,664,625

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

plus strand

 

 

Reference Sequence 

5' flank: aggaggattt ggtcctttgg ctggggtttg ccatcctttg gtatagattg tatagaaaga

          ctgaaaactc tatttaatca gttaattaac tcatatgaat ttgttaaaag atgagaaagc

          atcacaaaat gtgtgcctca ataacataat gactaggact cttctctgga gtttaaaagg

          aattctctgg cagtgtcttc aggccctatg ccctggtggt caccctgaga agacgtcttc

          agggcagggc tgtgtctatg acccagctca ccttgctcca ctccaaccaa gctccattcc

          tagtgtgctg aggatccaca cagggaatga cagggaacca ct

Observed:  W(a/t)

3' flank: atatcacaaa aggcctaggc ctctgggctg cctgcatggg tgactttcca agatcagtcg

          agtgaacaag gagttggtct taaaagatgt acagcaaacc cttgaagctt tgctgaaaaa

          acaactcaca aaaagcagat taacaggaga aaagatgtga tatggattca gttaatgaga

          actcagggaa gtgaccagca gttaattgtt ttcttctttg gtaggtctgg actttaggca

          gacaagg

          

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

 

 

 

 

FSS N. European (86)

T = 26%

A = 74%

1

FSS Indo-Pakistani (22)

 

 

 

FSS Afro-Caribbean (34)

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) :  cagggaatgacagggaaccact(a/t)

1

Reverse  Primers  :   ctgtacatcttttaagaccaactcctt

Detection probe   :   n/a

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

Forward Primer(s) :

 

Reverse  Primers  :

Detection probe   :  

 

 

General Comments  (e.g., utility/usage in multiplexes, multi-copy locus, equivalent to other               

markers-Y SNPs, present in commercial assay)

 

Present in FSS  Autosomal Snp Multiplex Assay (1)

Amplicon size in PCR (1)  : 157 bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctatcagggaatgacagggaaccacta

                              Forward Universal Sequence 2: tgacgtggctgacctgagaccagggaatgacagggaaccactt

                              Reverse Universal Sequence : caagctggtggctgtgcaagctgtacatcttttaagaccaactcctt

 

 References

1      FSS SNP PAPER

 

 

 RETURN TO HOMEPAGE