SNP/Locus Name /TSC Designation:  TSC 1342445

 

 

General Information

  GenBank Entries

NCBI Submitted SNP ID

NCBI Reference SNP ID

Genomic location

NT_022459 
NT_022459.12
AC024437.3

ss  3259114

Chr 3

rs 2311046

79,101,158

 

 

General Details

Polymorphism

(ancestral/derived, if known)

Orientation with respect to GenBank accession (+/-)

A/T

Minus strand

 

 

Reference Sequence 

5' flank: acataatttt acagggaaaa agattggaag agctaaataa actatttatc catgtttgag

          agtaaaattt aataaactct tgccaaaata caaatagttt atctatatga agcagtcatg

          gattctacat cctatcacat gaatttatgg ataagataaa caaagaacaa caccttgagg

          gattaaagca cagcagcagt aagttttgac agggtgggga gaatgctgaa tagaaaatgc

          tgccaggaag gcaaacgtgc tggaggcacc acagcatggg ggacagggag acaggcccat

          gc

Observed:  W(a/t)

3' flank: ggaggctggc accgagggaa aagagagttt cccagactag ttagttctga atggctatta

          cgcaagccct ggttaaggcc taaagtggac agagcagaga gagacagaga gagagagaaa

          gagagagaga atgtgtgata gtgagagaga gagagagaga gagagtgacc ataagagaga

          tttagtatgt tccttaaatg cataacttaa aagaacatca aatatttgct ttctctgtaa

          taaaaatatt gagtatatat atattggagg ttaaaaaggg acagtggtgg gggcagaggt

          tggcagggtg ttgagggact tgcatgagca agaacatgag gactgccatt ccaattaatc

          agtgttttac ctttgtcatg caaagtctgc tcatctgctt aattaagata gtcaagtcct

          ttgtgtacaa tttggattat caagttgtaa acattcaaaa tagttttagg tttatcttct

          ctgatctgct agcacga

 

 

 

Population Allele Frequencies

Panel (No. of Individuals)

Allele 1 Frequency

Allele 2 Frequency

References

FSS N. European (86)

A = 60%

T= 40%

1

FSS Indo-Pakistani (33)

A = 53%

T = 47%

1

FSS Afro-Caribbean (29)

A = 71%

T = 29%

1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Detection Protocols

Detection Protocol

PCR Primer/Probe Sequences

Reference

FSS URP Autosomal SNP Detection Protocol

Forward Primer(s) : gggagacaggcccatgc(a/t)

1

Reverse  Primers  :  gccattcagaactaactagtctggga

Detection probe   :   n/a

 

 

General Comments 

 

Present in FSS  Autosomal SNP Multiplex Assay (1)

Amplicon size in PCR (2)  : 113bp

PCR Cycling Conditions : 95c 11mins ; 94c 30s,

                                          60c 15s, 72c 15s, 60c 15s, 72c , 60c 15s, 72c 30s   x6   Cycles

                                          94c 30s, 76c 105s                                                     x29 Cycles

                                          94c 60s, 60c 30s, 72c 60s                                         x3   Cycles

                                          60c 10mins

URP Sequences :  Forward Universal Sequence 1: cgacgtggtggatgtgctat gggagacaggcccatgca

                                    Forward Universal Sequence 2: tgacgtggctgacctgagac gggagacaggcccatgct

                                    Reverse Universal Sequence    : caagctggtggctgtgcaag gccattcagaactaactagtctggga

 

 References

1               FSS SNP PAPER

 

 

 

 

 RETURN TO HOMEPAGE