A Y-Chromosome SNP Assay for Co-amplification of 25 DNA Fragments and Simultaneous Detection of 35 Human Y-SNPs

Juan J. Sanchez et al. (2003) Forensic Sci. Int., 137(1):74-84; Email address: juan.sanchez@forensic.ku.dk

 

Table 1: Y Chromosome single nucleotide polymorphisms (SNPs) and primer sequences for PCR amplification

Locus

GenBank  or

dbSNPs accesion

Mutation

PCR Primers

Forward Primer

 (5’ à 3’)

Reverse Primer

mM

Amplicon

 Size (bp)

M2/sY81

Rs3893

A/G

acggaaggagttctaaaattcagg

aaaatacagctccccctttatcct

0.15

128

M9*

Rs3900

C/G

aggaccctgaaatacagaactg

aaatatttcaacatttcacaaaggaa

 0.36

186

M17*

Rs3908

4G/3G

cctggtcataacactggaaatc

agctgaccacaaactgatgtaga

0.09

170

M18*

Rs3909

2 bp insertion

cctggtcataacactggaaatc

agctgaccacaaactgatgtaga

0.09

170

M19*

Rs3010

T/A

cctggtcataacactggaaatc

agctgaccacaaactgatgtaga

0.09

170

M32*

AC009977

T/C

tgaccgtcataggctgagaca

ttgaagcccccaagagagac

0.07

160

M33*

AC009977

A/C

tgaccgtcataggctgagaca

ttgaagcccccaagagagac

0.07

160

M35

Rs1179188

G/C

agggcatggtccctttctat

tccatgcagactttcggagt

0.42

96

M40/SRY4064

AC006040

G/A

tggtctcaatctcttcaccctgt

catttcagtaaatgccacacaaga

0.18

119

M45*

Rs2032631

G/A

gagagaggatatcaaaaattggcagt

tgacagtggcaccaaaggtc

0.03

138

M46/Tat

AC002531

T/C

tatatggactctgagtgtagacttgtga

ggtgccgtaaaagtgtgaaataatc

0.46

115

M52

AC009977

A/C

cctcaacttcccagagtgttg

gacgaagcaaacatttcaagagag

0.03

152

M78*

AC010889

C/T

tgcattactccgtatgttcgac

tggaagcttaccatctttttatga

0.08

132

M81*

Rs2032640

C/T

catctcttaacaaaagaggtaaattttgtcc

cattgtgttacatggcctataatattcagt

0.24

179

M89

Rs2032652

C/T

tggattcagctctcttcctaaggttat

ctgctcaggtacacacagagtatca

0.03

135

M96

AC010889

G/C

tgccctctcacagagcactt

ccacccactttgttgctttg

0.27

143

M123

AC010889

G/A

gttgcccaggaatttgcat

cacagagcaagtgactctcaaag

0.02

88

M139*

AC010137

5G/4G

ccccgaaagttttattttattcca

ttctcagacaccaatggtcctatc

0.06

113

M151*

AC010889

G/A

catctcttaacaaaagaggtaaattttgtcc

cattgtgttacatggcctataatattcagt

0.24

179

M153*

AC010137

T/A

ccccgaaagttttattttattcca

ttctcagacaccaatggtcctatc

0.06

113

M154*

AC010889

T/C

catctcttaacaaaagaggtaaattttgtcc

cattgtgttacatggcctataatattcagt

0.24

179

M157*

AC010889

A/C

gagagaggatatcaaaaattggcagt

tgacagtggcaccaaaggtc

0.03

138

M163*

AC009977

A/C

aggaccctgaaatacagaactg

aaatatttcaacatttcacaaaggaa

0.36

186

M167/SRY2627

AC006040

C/T

cggaaccactaccagcttca

agttaaggccccacgcagt

0.03

113

M170

Rs2032597

A/C

cagctcttattaagttatgttttcatattctgtg

gtcctcattttacagtgagacacaac

0.07

119

M172

Rs2032604

T/G

tgagccctctccatcagaag

gccaggtacagagaaagtttgg

0.16

179

M173

Rs2032624

A/C

ttttcttacaattcaagggcatttag

ctgaaaacaaaacactggcttatca

0.10

81

M175

Rs2032678

-5bp

gatttaaactctctgaatcaggcacat

ttctactgatacctttgtttctgttcattc

0.02

79

M212*

Rs2032664

C/A

ccatataaaaacgcagcattctgtt

tggagagaacttgagaaaaagtagagaa

0.12

176

M213*

Rs2032665

T/C

ccatataaaaacgcagcattctgtt

tggagagaacttgagaaaaagtagagaa

0.12

176

M224*

AC010889

T/C

tgcattactccgtatgttcgac

tggaagcttaccatctttttatga

0.08

132

SRY10831/SRY1532

Rs2534636

A/G

tcatccagtccttagcaaccatta

ccacataggtgaaccttgaaaatg

0.06

150

12f2

AC005820

present/absent

cactgactgatcaaaatgcttacagat

ggatcccttccttacaccttataca

0.06

90

92R7

Rs2535813

GA/A

ttaaatccctcctatttgtgctaacc

aatgcatgaacacaaaagacgtaga

0.04

89

P25

Rs150173

C/CA

tggaccatcacctgggtaaagt

ggcagtataaggttgtcacatcacat

0.01

109

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

*SNP markers on the same DNA fragment: (M9 and M163), (M17, M18 and M19), (M32 and M33), (M45 and M157), (M78 and M224), (M81, M151 and M154), (M139 and M153), (M212 and M213). All primers were redesigned compared to previously published primers.

 

Table 2: Minisequencing primer sequences of 35 Y chromosome SNP markers

Locus

Poly (dC)

Neutral Sequence

(5’à3’)

Target specific sequence

(5’à 3’)

Orientation*

mM

Primer

Size (nt)§

M170

None

None  

  caacccacactgaaaaaaa

Reverse

0.02

19

M45

None

caa 

  ctcagaaggagctttttgc

Reverse

0.02

22

M139

None

aa

  taatctgacttggaaagggg

Forward

0.01

22

M2/sY81

None

gacaa

  ctttatcctccacagatctca

Reverse

0.28

26

M46/Tat

None

None

  gctctgaaatattaaattaaaacaac

Reverse

0.25

26

M167/SRY2627

None

tgaaagtctgacaa

  aagccccacagggtgc

Forward

0.35

30

M213

None

tgacaa

  tcagaacttaaaacatctcgttac

Reverse

0.02

30

M52

None

tctgacaa

  aatatcaagaaacctatcaaacatcc

Reverse

0.02

34

P25

None

tcgtgaaagtctgacaa

  tgcctgaaacctgcctg

Forward

0.04

34

M78

None

gaaagtctgacaa

  cttattttgaaatatttggaagggc

Reverse

0.02

38

92R7

None

gtgaaagtctgacaa

  catgaacacaaaagacgtagaag

Reverse

0.01

38

M89

None

cacgtcgtgaaagtctgacaa

  aactcaggcaaagtgagagat

Reverse

0.09

42

M123

None

acgtcgtgaaagtctgacaa

  atttctaggtattcaggcgatg

Reverse

0.03

42

M35

None

ggtgccacgtcgtgaaagtctgacaa

  tcggagtctctgcctgtgtc

Reverse

0.25

46

M153

None

ggtgccacgtcgtgaaagtctgacaa

  gctcaaagggtatgtgaaca

Forward

0.02

46

M40/SRY4064

None

aaactaggtgccacgtcgtgaaagtctgacaa

  tccaccctgtgatccgct

Reverse

0.08

50

M154

None

gccacgtcgtgaaagtctgacaa

  gttacatggcctataatattcagtaca

Reverse

0.03

50

M32

None

taggtgccacgtcgtgaaagtctgacaa

  agacaagatctgttcagtttatctca

Forward

0.50

54

M151

None

aggtgccacgtcgtgaaagtctgacaa

  caatctactacatacctacgctatatg

Forward

0.02

54

M17

None

actaaactaggtgccacgtcgtgaaagtctgacaa

  ccaaaattcacttaaaaaaaccc

Reverse

0.02

58

M96

None

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  ggaaaacaggtctctcataata

Forward

0.15

62

M172

7(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  caaacccattttgatgctt

Forward

0.10

66

M173

3(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  tacaattcaagggcatttagaac

Forward

0.03

66

M19

4(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  aaactatttttgtgaagactgttgta

Forward

0.10

70

M224

7(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  aattgatacacttaacaaagatacttc

Forward

0.13

74

SRY10831/SRY1532

10(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  ttgtatctgactttttcacacagt

Forward

0.03

74

M18

17(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  gtttgtggttgctggttgtta

Forward

0.05

78

M157

18(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  caccaaaggtcatttgtggt

Reverse

0.20

78

M81

14(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  cttggtttgtgtgagtatactctatgac

Reverse

0.03

82

M163

25(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  cacaaaggaattttttttgag

Reverse

0.51

86

M212

20(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  gcattctgttaatataaaacacaaaa

Forward

0.20

86

M9

22(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  catgtctaaattaaagaaaaataaagag

Reverse

0.40

90

12f2

29(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  aacatgtaagtctttaatccatctc

Forward

0.02

94

M33

29(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  cagttacaaaagtataatatgtctgagat

Reverse

0.18

98

M175

46(dC)

aactgactaaactaggtgccacgtcgtgaaagtctgacaa

  cacatgccttctcacttctc

Forward

0.28

106

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

*The detection orientation has been probed relative to the YCC information reported in The Y Chromosome Consortium, A nomenclature system for the tree of human Y-chromosomal binary haplogroups, Genome Res. 12 (2002) 339-3480.

 

GeneScan analysis of SNaPshot™ minisequencing of the Y chromosome SNP multiplex.