Input file Format

Home Download Tips for running Example Input Referencing AutoDimer FAQ Support

Briefly, a ">" followed by a label for the sequence followed by a hard; then the sequence of interest followed by a hard return.  An input file must contain at least 2 sequences.

The example text below can be copied and pasted into a basic word notepad file (or download it here).

>label for sequence

gcagtcgtatcgtagtgctgactagtcgta

>477-F

CTTTTGGCGGTATGCACTTT

>477-R

GGTGTGTGTGTGCTGGGTA

>3010-F

GCGCAATCCTATTCTAGAGTCC

>3010-R

TCACGTAGGACTTTAATCGTTGA

>4580-F

TCTTTGCAGGCACACTCATC

>4580-R

GCAGCTTCTGTGGAACGAG

>4793-F

CAACCGCATCCATAATCCTT

>4793-R

ATGTCAGAGGGGTGCCTTG

>5004-F

TCCATCATAGCAGGCAGTTG

>5004-R

TGGTTATGTTAGGGTTGTACGG

>7028-F

GGCCTGACTGGCATTGTATT

>7028-R

AAGCCTCCTATGATGGCAAA

>7202-F

ACGCCAAAATCCATTTCACT

>7202-R

TTCATGTGGTGTATGCATCG

>10211-F

ACCACAACTCAACGGCTACA

>10211-R

GGAGGGCAATTTCTAGATCAAA

>12858-F

ATGATACGCCCGAGCAGA

>12858-R

TGTGGGTCTCATGAGTTGGA

>14470-F

CAAGACCTCAACCCCTGACC

>14470-R

GGGGGAGGTTATATGGGTTT

>16519-F

ACCACCATCCTCCGTGAAAT

>16519-R         

AGACCTGTGATCCATCGTGA